{ "swagger": "2.0", "info": { "description": "This page shows how to use HTTP requests to access the Genome Nexus API. There are more high level clients available in Python, R, JavaScript, TypeScript and various other languages as well as a command line client to annotate MAF and VCF. See https://docs.genomenexus.org/api.\n\nAside from programmatic clients there are web based tools to annotate variants, see https://docs.genomenexus.org/tools.\n\n We currently only provide long-term support for the '/annotation' endpoint. The other endpoints might change.", "version": "2.0", "title": "Genome Nexus API", "license": { "name": "MIT License", "url": "https://github.com/genome-nexus/genome-nexus/blob/master/LICENSE" } }, "tags": [ { "name": "cross-reference-controller", "description": "Cross Reference Controller" }, { "name": "signal-mutation-controller", "description": "Signal Mutation Controller" }, { "name": "search-controller", "description": "Search Controller" }, { "name": "cancer-hotspots-controller", "description": "Cancer Hotspots Controller" }, { "name": "mutation-assessor-controller", "description": "Mutation Assessor Controller" }, { "name": "annotation-summary-controller", "description": "Annotation Summary Controller" }, { "name": "curious-cases-controller", "description": "Curious Cases Controller" }, { "name": "signal-query-controller", "description": "Signal Query Controller" }, { "name": "my-variant-info-controller", "description": "My Variant Info Controller" }, { "name": "nucleotide-context-controller", "description": "Nucleotide Context Controller" } ], "schemes": [ "http", "https" ], "paths": { "/annotation/summary": { "post": { "tags": [ "annotation-summary-controller" ], "summary": "Retrieves VEP annotation summary for the provided list of variants", "operationId": "fetchVariantAnnotationSummaryPOST", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "in": "body", "name": "variants", "description": "List of variants. For example [\"X:g.66937331T>A\",\"17:g.41242962_41242963insGA\"] (GRCh37) or [\"1:g.182712A>C\", \"2:g.265023C>T\", \"3:g.319781del\", \"19:g.110753dup\", \"1:g.1385015_1387562del\"] (GRCh38)", "required": true, "schema": { "type": "array", "items": { "type": "string" } } }, { "name": "isoformOverrideSource", "in": "query", "description": "Isoform override source. For example uniprot", "required": false, "type": "string" }, { "name": "projection", "in": "query", "description": "Indicates whether to return summary for all transcripts or only for canonical transcript", "required": false, "type": "string", "default": "ALL", "enum": [ "ALL", "CANONICAL" ] } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/VariantAnnotationSummary" } } } } } }, "/annotation/summary/{variant}": { "get": { "tags": [ "annotation-summary-controller" ], "summary": "Retrieves VEP annotation summary for the provided variant", "operationId": "fetchVariantAnnotationSummaryGET", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "name": "variant", "in": "path", "description": "Variant. For example 17:g.41242962_41242963insGA", "required": true, "type": "string" }, { "name": "isoformOverrideSource", "in": "query", "description": "Isoform override source. For example uniprot", "required": false, "type": "string" }, { "name": "projection", "in": "query", "description": "Indicates whether to return summary for all transcripts or only for canonical transcript", "required": false, "type": "string", "default": "ALL", "enum": [ "ALL", "CANONICAL" ] } ], "responses": { "200": { "description": "OK", "schema": { "$ref": "#/definitions/VariantAnnotationSummary" } } } } }, "/cancer_hotspots/genomic": { "post": { "tags": [ "cancer-hotspots-controller" ], "summary": "Retrieves hotspot annotations for the provided list of genomic locations", "operationId": "fetchHotspotAnnotationByGenomicLocationPOST", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "in": "body", "name": "genomicLocations", "description": "List of genomic locations.", "required": true, "schema": { "type": "array", "items": { "$ref": "#/definitions/GenomicLocation" } } } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/AggregatedHotspots" } } } } } }, "/cancer_hotspots/genomic/{genomicLocation}": { "get": { "tags": [ "cancer-hotspots-controller" ], "summary": "Retrieves hotspot annotations for a specific genomic location", "operationId": "fetchHotspotAnnotationByGenomicLocationGET", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "name": "genomicLocation", "in": "path", "description": "A genomic location. For example 7,140453136,140453136,A,T", "required": true, "type": "string" } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/Hotspot" } } } } } }, "/cancer_hotspots/hgvs": { "post": { "tags": [ "cancer-hotspots-controller" ], "summary": "Retrieves hotspot annotations for the provided list of variants", "operationId": "fetchHotspotAnnotationByHgvsPOST", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "in": "body", "name": "variants", "description": "List of variants. For example [\"7:g.140453136A>T\",\"12:g.25398285C>A\"]", "required": true, "schema": { "type": "array", "items": { "type": "string" } } } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/AggregatedHotspots" } } } } } }, "/cancer_hotspots/hgvs/{variant}": { "get": { "tags": [ "cancer-hotspots-controller" ], "summary": "Retrieves hotspot annotations for a specific variant", "operationId": "fetchHotspotAnnotationByHgvsGET", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "name": "variant", "in": "path", "description": "A variant. For example 7:g.140453136A>T", "required": true, "type": "string" } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/Hotspot" } } } } } }, "/cancer_hotspots/proteinLocations": { "post": { "tags": [ "cancer-hotspots-controller" ], "summary": "Retrieves hotspot annotations for the provided list of transcript id, protein location and mutation type", "operationId": "fetchHotspotAnnotationByProteinLocationsPOST", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "in": "body", "name": "proteinLocations", "description": "List of transcript id, protein start location, protein end location, mutation type. \bThe mutation types are limited to 'Missense_Mutation', 'In_Frame_Ins', 'In_Frame_Del', 'Splice_Site', and 'Splice_Region'", "required": true, "schema": { "type": "array", "items": { "$ref": "#/definitions/ProteinLocation" } } } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/AggregatedHotspots" } } } } } }, "/cancer_hotspots/transcript": { "post": { "tags": [ "cancer-hotspots-controller" ], "summary": "Retrieves hotspot annotations for the provided list of transcript ID", "operationId": "fetchHotspotAnnotationByTranscriptIdPOST", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "in": "body", "name": "transcriptIds", "description": "List of transcript Id. For example [\"ENST00000288602\",\"ENST00000256078\"]", "required": true, "schema": { "type": "array", "items": { "type": "string" } } } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/AggregatedHotspots" } } } } } }, "/cancer_hotspots/transcript/{transcriptId}": { "get": { "tags": [ "cancer-hotspots-controller" ], "summary": "Retrieves hotspot annotations for the provided transcript ID", "operationId": "fetchHotspotAnnotationByTranscriptIdGET", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "name": "transcriptId", "in": "path", "description": "A Transcript Id. For example ENST00000288602", "required": true, "type": "string" } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/Hotspot" } } } } } }, "/curious_cases/{genomicLocation}": { "get": { "tags": [ "curious-cases-controller" ], "summary": "Retrieves Curious Cases info by a genomic location", "operationId": "fetchCuriousCasesGET", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "name": "genomicLocation", "in": "path", "description": "Genomic location, for example: 7,116411883,116411905,TTCTTTCTCTCTGTTTTAAGATC,-", "required": true, "type": "string" } ], "responses": { "200": { "description": "OK", "schema": { "$ref": "#/definitions/CuriousCases" } } } } }, "/mutation_assessor": { "post": { "tags": [ "mutation-assessor-controller" ], "summary": "Retrieves mutation assessor information for the provided list of variants", "operationId": "postMutationAssessorAnnotation", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "in": "body", "name": "variants", "description": "List of variants. For example [\"7:g.140453136A>T\",\"12:g.25398285C>A\"]", "required": true, "schema": { "type": "array", "items": { "type": "string" } } } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/MutationAssessor" } } } } } }, "/mutation_assessor/{variant}": { "get": { "tags": [ "mutation-assessor-controller" ], "summary": "Retrieves mutation assessor information for the provided list of variants", "operationId": "fetchMutationAssessorAnnotationGET", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "name": "variant", "in": "path", "description": "A variant. For example 7:g.140453136A>T", "required": true, "type": "string" } ], "responses": { "200": { "description": "OK", "schema": { "$ref": "#/definitions/MutationAssessor" } } } } }, "/my_variant_info/variant": { "post": { "tags": [ "my-variant-info-controller" ], "summary": "Retrieves myvariant information for the provided list of variants", "operationId": "postMyVariantInfoAnnotation", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "in": "body", "name": "variants", "description": "List of variants. For example [\"7:g.140453136A>T\",\"12:g.25398285C>A\"]", "required": true, "schema": { "type": "array", "items": { "type": "string" } } } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/MyVariantInfo" } } } } } }, "/my_variant_info/variant/{variant}": { "get": { "tags": [ "my-variant-info-controller" ], "summary": "Retrieves myvariant information for the provided list of variants", "operationId": "fetchMyVariantInfoAnnotationGET", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "name": "variant", "in": "path", "description": ". For example 7:g.140453136A>T", "required": true, "type": "string" } ], "responses": { "200": { "description": "OK", "schema": { "$ref": "#/definitions/MyVariantInfo" } } } } }, "/nucleotide_context": { "post": { "tags": [ "nucleotide-context-controller" ], "summary": "Retrieves nucleotide context information for the provided list of variants", "operationId": "postNucleotideContextAnnotation", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "in": "body", "name": "variants", "description": "List of variants. For example [\"7:g.140453136A>T\",\"12:g.25398285C>A\"]", "required": true, "schema": { "type": "array", "items": { "type": "string" } } } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/NucleotideContext" } } } } } }, "/nucleotide_context/{variant}": { "get": { "tags": [ "nucleotide-context-controller" ], "summary": "Retrieves nucleotide context information for the provided list of variants", "operationId": "fetchNucleotideContextAnnotationGET", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "name": "variant", "in": "path", "description": "A variant. For example 7:g.140453136A>T", "required": true, "type": "string" } ], "responses": { "200": { "description": "OK", "schema": { "$ref": "#/definitions/NucleotideContext" } } } } }, "/search": { "get": { "tags": [ "search-controller" ], "summary": "Performs index search.", "operationId": "searchAnnotationByKeywordGETUsingGET", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "name": "keyword", "in": "query", "description": "keyword. For example 13:g.32890665G>A, TP53 p.R273C, BRAF c.1799T>A", "required": true, "type": "string" }, { "name": "limit", "in": "query", "description": "Max number of matching results to return", "required": false, "type": "integer", "format": "int32" } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/IndexSearch" } } } } } }, "/signal/mutation": { "get": { "tags": [ "signal-mutation-controller" ], "summary": "Retrieves SignalDB mutations by Hugo Gene Symbol", "operationId": "fetchSignalMutationsByHugoSymbolGETUsingGET", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "name": "hugoGeneSymbol", "in": "query", "description": "Hugo Symbol. For example BRCA1", "required": false, "type": "string" } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/SignalMutation" } } } } }, "post": { "tags": [ "signal-mutation-controller" ], "summary": "Retrieves SignalDB mutations by Mutation Filter", "operationId": "fetchSignalMutationsByMutationFilterPOSTUsingPOST", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "in": "body", "name": "mutationFilter", "description": "List of Hugo Gene Symbols. For example [\"TP53\", \"PIK3CA\", \"BRCA1\"]", "required": true, "schema": { "$ref": "#/definitions/SignalMutationFilter" } } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/SignalMutation" } } } } } }, "/signal/mutation/hgvs/{variant}": { "get": { "tags": [ "signal-mutation-controller" ], "summary": "Retrieves SignalDB mutations by hgvgs variant", "operationId": "fetchSignalMutationsByHgvsgGETUsingGET", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "name": "variant", "in": "path", "description": "A variant. For example 13:g.32890665G>A", "required": true, "type": "string" } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/SignalMutation" } } } } } }, "/signal/search": { "get": { "tags": [ "signal-query-controller" ], "summary": "Performs search by gene, protein change, variant or region.", "operationId": "searchSignalByKeywordGETUsingGET", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "name": "keyword", "in": "query", "description": "keyword. For example BRCA; BRAF V600; 13:32906640-32906640; 13:g.32890665G>A", "required": true, "type": "string" }, { "name": "limit", "in": "query", "description": "Max number of matching results to return", "required": false, "type": "integer", "format": "int32" } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/SignalQuery" } } } } } }, "/xrefs/{accession}": { "get": { "tags": [ "cross-reference-controller" ], "summary": "Perform lookups of Ensembl identifiers and retrieve their external references in other databases", "operationId": "fetchGeneXrefsGET_1", "consumes": [ "application/json" ], "produces": [ "application/json" ], "parameters": [ { "name": "accession", "in": "path", "description": "Ensembl gene accession. For example ENSG00000169083", "required": true, "type": "string" } ], "responses": { "200": { "description": "OK", "schema": { "type": "array", "items": { "$ref": "#/definitions/GeneXref" } } } }, "deprecated": true } } }, "definitions": { "AggregatedHotspots": { "type": "object", "required": [ "genomicLocation", "hotspots", "variant" ], "properties": { "genomicLocation": { "description": "Genomic Location", "$ref": "#/definitions/GenomicLocation" }, "hotspots": { "type": "array", "description": "Hotspots", "items": { "$ref": "#/definitions/Hotspot" } }, "proteinLocation": { "$ref": "#/definitions/ProteinLocation" }, "transcriptId": { "type": "string" }, "variant": { "type": "string", "description": "HGVS notation" } } }, "AlleleCount": { "type": "object", "required": [ "ac", "ac_afr", "ac_amr", "ac_asj", "ac_eas", "ac_fin", "ac_nfe", "ac_oth", "ac_sas" ], "properties": { "ac": { "type": "integer", "format": "int32" }, "ac_afr": { "type": "integer", "format": "int32" }, "ac_amr": { "type": "integer", "format": "int32" }, "ac_asj": { "type": "integer", "format": "int32" }, "ac_eas": { "type": "integer", "format": "int32" }, "ac_fin": { "type": "integer", "format": "int32" }, "ac_nfe": { "type": "integer", "format": "int32" }, "ac_oth": { "type": "integer", "format": "int32" }, "ac_sas": { "type": "integer", "format": "int32" } } }, "AlleleFrequency": { "type": "object", "required": [ "af", "af_afr", "af_amr", "af_asj", "af_eas", "af_fin", "af_nfe", "af_oth", "af_sas" ], "properties": { "af": { "type": "number", "format": "double" }, "af_afr": { "type": "number", "format": "double" }, "af_amr": { "type": "number", "format": "double" }, "af_asj": { "type": "number", "format": "double" }, "af_eas": { "type": "number", "format": "double" }, "af_fin": { "type": "number", "format": "double" }, "af_nfe": { "type": "number", "format": "double" }, "af_oth": { "type": "number", "format": "double" }, "af_sas": { "type": "number", "format": "double" } } }, "AlleleNumber": { "type": "object", "required": [ "an", "an_afr", "an_amr", "an_asj", "an_eas", "an_fin", "an_nfe", "an_oth", "an_sas" ], "properties": { "an": { "type": "integer", "format": "int32" }, "an_afr": { "type": "integer", "format": "int32" }, "an_amr": { "type": "integer", "format": "int32" }, "an_asj": { "type": "integer", "format": "int32" }, "an_eas": { "type": "integer", "format": "int32" }, "an_fin": { "type": "integer", "format": "int32" }, "an_nfe": { "type": "integer", "format": "int32" }, "an_oth": { "type": "integer", "format": "int32" }, "an_sas": { "type": "integer", "format": "int32" } } }, "Alleles": { "type": "object", "properties": { "allele": { "type": "string", "description": "allele" } } }, "ClinVar": { "type": "object", "properties": { "alleleId": { "type": "integer", "format": "int32", "description": "allele_id" }, "alt": { "type": "string", "description": "alt" }, "chrom": { "type": "string", "description": "chrom" }, "cytogenic": { "type": "string", "description": "cytogenic" }, "gene": { "description": "gene", "$ref": "#/definitions/Gene" }, "hg19": { "description": "hg19", "$ref": "#/definitions/Hg19" }, "hg38": { "description": "hg38", "$ref": "#/definitions/Hg38" }, "hgvs": { "description": "hgvs", "$ref": "#/definitions/Hgvs" }, "license": { "type": "string", "description": "license" }, "rcv": { "type": "array", "items": { "$ref": "#/definitions/Rcv" } }, "variantId": { "type": "integer", "format": "int32", "description": "variant_id" } } }, "Cosmic": { "type": "object", "properties": { "alt": { "type": "string", "description": "alt" }, "chrom": { "type": "string", "description": "chrom" }, "cosmicId": { "type": "string", "description": "cosmic_id" }, "hg19": { "description": "hg19", "$ref": "#/definitions/Hg19" }, "license": { "type": "string", "description": "_license" }, "mutFreq": { "type": "number", "format": "double", "description": "mut_freq" }, "mutNt": { "type": "string", "description": "mut_nt" }, "ref": { "type": "string", "description": "ref" }, "tumorSite": { "type": "string", "description": "tumor_site" } } }, "CountByTumorType": { "type": "object", "properties": { "tumorType": { "type": "string", "description": "Tumor Type" }, "tumorTypeCount": { "type": "integer", "format": "int32", "description": "Sample count for Tumor Type" }, "variantCount": { "type": "integer", "format": "int32", "description": "Variant count for Tumor Type" } } }, "CuriousCases": { "type": "object", "properties": { "comment": { "type": "string" }, "genomicLocation": { "type": "string" }, "hugoGeneSymbol": { "type": "string" }, "pubmedIds": { "type": "array", "items": { "type": "integer", "format": "int32" } } } }, "Dbsnp": { "type": "object", "properties": { "_class": { "type": "string", "description": "class" }, "alleleOrigin": { "type": "string", "description": "allele_origin" }, "alleles": { "type": "array", "description": "alleles", "items": { "$ref": "#/definitions/Alleles" } }, "alt": { "type": "string", "description": "alt" }, "chrom": { "type": "string", "description": "chrom" }, "dbsnpBuild": { "type": "integer", "format": "int32", "description": "dbsnp_build" }, "flags": { "type": "array", "description": "flags", "items": { "type": "string" } }, "hg19": { "description": "hg19", "$ref": "#/definitions/Hg19" }, "license": { "type": "string", "description": "_license" }, "ref": { "type": "string", "description": "ref" }, "rsid": { "type": "string", "description": "rsid" }, "validated": { "type": "boolean", "example": false, "description": "validated" }, "varSubtype": { "type": "string", "description": "var_subtype" }, "vartype": { "type": "string", "description": "vartype" } } }, "Gene": { "type": "object", "properties": { "geneId": { "type": "string", "description": "geneid" }, "symbol": { "type": "string", "description": "symbol" } } }, "GeneXref": { "type": "object", "required": [ "db_display_name", "dbname", "description", "display_id", "primary_id", "version" ], "properties": { "db_display_name": { "type": "string", "description": "Database display name" }, "dbname": { "type": "string", "description": "Database name" }, "description": { "type": "string", "description": "Description" }, "display_id": { "type": "string", "description": "Display id" }, "ensemblGeneId": { "type": "string" }, "info_text": { "type": "string", "description": "Database info text" }, "info_types": { "type": "string", "description": "Database info type" }, "primary_id": { "type": "string", "description": "Primary id" }, "synonyms": { "type": "array", "description": "Synonyms", "items": { "type": "string" } }, "version": { "type": "string", "description": "Version" } } }, "GeneralPopulationStats": { "type": "object", "properties": { "counts": { "description": "Counts", "$ref": "#/definitions/SignalPopulationStats" }, "frequencies": { "description": "Frequencies", "$ref": "#/definitions/SignalPopulationStats" } } }, "GenomicLocation": { "type": "object", "required": [ "chromosome", "end", "referenceAllele", "start", "variantAllele" ], "properties": { "chromosome": { "type": "string", "description": "Chromosome" }, "start": { "type": "integer", "format": "int32", "description": "Start Position" }, "end": { "type": "integer", "format": "int32", "description": "End Position" }, "referenceAllele": { "type": "string", "description": "Reference Allele" }, "variantAllele": { "type": "string", "description": "Variant Allele" } } }, "Gnomad": { "type": "object", "properties": { "alleleCount": { "description": "ac", "$ref": "#/definitions/AlleleCount" }, "alleleFrequency": { "description": "af", "$ref": "#/definitions/AlleleFrequency" }, "alleleNumber": { "description": "an", "$ref": "#/definitions/AlleleNumber" }, "homozygotes": { "description": "hom", "$ref": "#/definitions/Homozygotes" } } }, "Hg19": { "type": "object", "properties": { "end": { "type": "integer", "format": "int32", "description": "end" }, "start": { "type": "integer", "format": "int32", "description": "start" } } }, "Hg38": { "type": "object", "properties": { "end": { "type": "string", "description": "end" }, "start": { "type": "string", "description": "start" } } }, "Hgvs": { "type": "object", "properties": { "coding": { "type": "array", "items": { "type": "string" } }, "genomic": { "type": "array", "items": { "type": "string" } }, "protein": { "type": "array", "items": { "type": "string" } } } }, "Homozygotes": { "type": "object", "required": [ "hom", "hom_afr", "hom_amr", "hom_asj", "hom_eas", "hom_fin", "hom_nfe", "hom_oth", "hom_sas" ], "properties": { "hom": { "type": "integer", "format": "int32" }, "hom_afr": { "type": "integer", "format": "int32" }, "hom_amr": { "type": "integer", "format": "int32" }, "hom_asj": { "type": "integer", "format": "int32" }, "hom_eas": { "type": "integer", "format": "int32" }, "hom_fin": { "type": "integer", "format": "int32" }, "hom_nfe": { "type": "integer", "format": "int32" }, "hom_oth": { "type": "integer", "format": "int32" }, "hom_sas": { "type": "integer", "format": "int32" } } }, "Hotspot": { "type": "object", "properties": { "hugoSymbol": { "type": "string", "description": "Hugo gene symbol" }, "inframeCount": { "type": "integer", "format": "int32", "description": "Inframe mutation count" }, "missenseCount": { "type": "integer", "format": "int32", "description": "Missense mutation count" }, "residue": { "type": "string", "description": "Hotspot residue" }, "spliceCount": { "type": "integer", "format": "int32", "description": "Splice mutation count" }, "transcriptId": { "type": "string", "description": "Ensembl Transcript Id" }, "truncatingCount": { "type": "integer", "format": "int32", "description": "Truncation mutation count" }, "tumorCount": { "type": "integer", "format": "int32", "description": "Tumor count" }, "type": { "type": "string", "description": "Hotspot type" } } }, "HrdScore": { "type": "object", "properties": { "fractionLoh": { "type": "number", "format": "double", "description": "Median HRD Fraction LOH" }, "lst": { "type": "number", "format": "double", "description": "Median HRD LST" }, "ntelomericAi": { "type": "number", "format": "double", "description": "Median HRD ntelomeric AI" } } }, "Index": { "type": "object", "properties": { "cdna": { "type": "array", "items": { "type": "string" } }, "hgvsc": { "type": "array", "items": { "type": "string" } }, "hgvsp": { "type": "array", "items": { "type": "string" } }, "hgvspShort": { "type": "array", "items": { "type": "string" } }, "hugoSymbol": { "type": "array", "items": { "type": "string" } }, "rsid": { "type": "array", "items": { "type": "string" } }, "variant": { "type": "string" } } }, "IndexSearch": { "type": "object", "properties": { "queryType": { "type": "string", "enum": [ "GENE_HGVSPSHORT", "GENE_CDNA", "GENE_HGVSP", "HGVSG", "HGVSC" ] }, "results": { "type": "array", "items": { "$ref": "#/definitions/Index" } } } }, "IntegerRange": { "type": "object", "properties": { "end": { "type": "integer", "format": "int32" }, "start": { "type": "integer", "format": "int32" } } }, "MutationAssessor": { "type": "object", "required": [ "input" ], "properties": { "codonStartPosition": { "type": "string", "description": "Codon start position" }, "cosmicCount": { "type": "integer", "format": "int32", "description": "Number of mutations in COSMIC for this protein" }, "functionalImpact": { "type": "string", "description": "Functional impact" }, "functionalImpactScore": { "type": "number", "format": "double", "description": "Functional impact score" }, "hgvs": { "type": "string" }, "hugoSymbol": { "type": "string", "description": "Hugo gene symbol" }, "input": { "type": "string", "description": "User-input variants" }, "mappingIssue": { "type": "string", "description": "Mapping issue info" }, "msaGaps": { "type": "number", "format": "double", "description": "Portion of gaps in variant position in multiple sequence alignment" }, "msaHeight": { "type": "integer", "format": "int32", "description": "Number of diverse sequences in multiple sequence alignment (identical or highly similar sequences filtered out)" }, "msaLink": { "type": "string", "description": "Link to multiple sequence alignment" }, "pdbLink": { "type": "string", "description": "Link to 3d structure browser" }, "referenceGenomeVariant": { "type": "string", "description": "Reference genome variant" }, "referenceGenomeVariantType": { "type": "string", "description": "Reference genome variant type" }, "refseqId": { "type": "string", "description": "Refseq protein ID" }, "refseqPosition": { "type": "integer", "format": "int32", "description": "Variant position in Refseq protein, can be different from the one in Uniprot" }, "refseqResidue": { "type": "string", "description": "Reference residue in Refseq protein, can be different from the one in Uniprot" }, "snpCount": { "type": "integer", "format": "int32", "description": "Number of SNPs in dbSNP for this protein" }, "uniprotId": { "type": "string", "description": "Uniprot protein accession ID" }, "uniprotPosition": { "type": "integer", "format": "int32", "description": "Variant position in Uniprot protein, can be different from the one in Refseq" }, "uniprotResidue": { "type": "string", "description": "Reference residue in Uniprot protein, can be different from the one in Refseq" }, "variant": { "type": "string", "description": "Amino acid substitution" }, "variantConservationScore": { "type": "number", "format": "double", "description": "Variant conservation score" }, "variantSpecificityScore": { "type": "number", "format": "double", "description": "Variant specificity score" } } }, "Mutdb": { "type": "object", "properties": { "alt": { "type": "string", "description": "alt" }, "chrom": { "type": "string", "description": "chrom" }, "cosmicId": { "type": "string", "description": "cosmic_id" }, "hg19": { "description": "hg19", "$ref": "#/definitions/Hg19" }, "mutpredScore": { "type": "number", "format": "double", "description": "mutpred_score" }, "ref": { "type": "string", "description": "ref" }, "rsid": { "type": "string", "description": "rsid" }, "uniprotId": { "type": "string", "description": "uniprot_id" } } }, "MyVariantInfo": { "type": "object", "properties": { "clinVar": { "description": "clinvar", "$ref": "#/definitions/ClinVar" }, "cosmic": { "description": "cosmic", "$ref": "#/definitions/Cosmic" }, "dbsnp": { "description": "dbsnp", "$ref": "#/definitions/Dbsnp" }, "gnomadExome": { "description": "gnomad_exome", "$ref": "#/definitions/Gnomad" }, "gnomadGenome": { "description": "gnomad_genome", "$ref": "#/definitions/Gnomad" }, "hgvs": { "type": "string", "description": "hgvs" }, "mutdb": { "$ref": "#/definitions/Mutdb" }, "query": { "type": "string" }, "snpeff": { "description": "snpeff", "$ref": "#/definitions/Snpeff" }, "variant": { "type": "string", "description": "variant" }, "vcf": { "description": "vcf", "$ref": "#/definitions/Vcf" }, "version": { "type": "integer", "format": "int32", "description": "version" } } }, "NucleotideContext": { "type": "object", "required": [ "seq" ], "properties": { "hgvs": { "type": "string" }, "id": { "type": "string" }, "molecule": { "type": "string" }, "query": { "type": "string" }, "seq": { "type": "string", "description": "Nucleotide context sequence" } } }, "ProteinLocation": { "type": "object", "required": [ "end", "mutationType", "start", "transcriptId" ], "properties": { "transcriptId": { "type": "string", "description": "Ensembl Transcript ID" }, "start": { "type": "integer", "format": "int32", "description": "Start Position Residue" }, "end": { "type": "integer", "format": "int32", "description": "End Position Residue" }, "mutationType": { "type": "string", "description": "Mutation Type e.g. Missense_Mutation" } } }, "Rcv": { "type": "object", "properties": { "accession": { "type": "string", "description": "accession" }, "clinicalSignificance": { "type": "string", "description": "clinical_significance" }, "origin": { "type": "string", "description": "origin" }, "preferredName": { "type": "string", "description": "preferred_name" } } }, "SignalMutation": { "type": "object", "properties": { "biallelicCountsByTumorType": { "type": "array", "description": "Biallelic Counts by Tumor Type", "items": { "$ref": "#/definitions/CountByTumorType" } }, "chromosome": { "type": "string", "description": "Chromosome" }, "countsByTumorType": { "type": "array", "description": "Counts by Tumor Type", "items": { "$ref": "#/definitions/CountByTumorType" } }, "endPosition": { "type": "integer", "format": "int64", "description": "End Position" }, "generalPopulationStats": { "description": "General Population Stats", "$ref": "#/definitions/GeneralPopulationStats" }, "hugoGeneSymbol": { "type": "string", "description": "Hugo Gene Symbol" }, "mskExperReview": { "type": "boolean", "example": false, "description": "Msk Expert Review" }, "mutationStatus": { "type": "string", "description": "Mutation Status" }, "overallNumberOfGermlineHomozygous": { "type": "integer", "format": "int32" }, "pathogenic": { "type": "string", "description": "Pathogenic" }, "penetrance": { "type": "string", "description": "Penetrance" }, "qcPassCountsByTumorType": { "type": "array", "description": "QC Pass Counts by Tumor Type", "items": { "$ref": "#/definitions/CountByTumorType" } }, "referenceAllele": { "type": "string", "description": "Reference Allele" }, "startPosition": { "type": "integer", "format": "int64", "description": "Start Position" }, "statsByTumorType": { "type": "array", "description": "Stats By Tumor Type", "items": { "$ref": "#/definitions/StatsByTumorType" } }, "variantAllele": { "type": "string", "description": "Variant Allele" } } }, "SignalMutationFilter": { "type": "object", "properties": { "hugoSymbols": { "type": "array", "description": "List of Hugo Symbols. For example [\"TP53\", \"PIK3CA\", \"BRCA1\"]", "items": { "type": "string" } } } }, "SignalPopulationStats": { "type": "object", "properties": { "afr": { "type": "number", "format": "double", "description": "African/African American" }, "asj": { "type": "number", "format": "double", "description": "Ashkenazi Jewish" }, "asn": { "type": "number", "format": "double", "description": "Asian" }, "eur": { "type": "number", "format": "double", "description": "European" }, "impact": { "type": "number", "format": "double", "description": "Impact" }, "oth": { "type": "number", "format": "double", "description": "Other" } } }, "SignalQuery": { "type": "object", "properties": { "alteration": { "type": "string", "description": "Matching Alteration (e.g: V600E)" }, "description": { "type": "string", "description": "Optional free-form text" }, "hugoSymbol": { "type": "string", "description": "Matching Hugo Gene Symbol (e.g: BRCA2, BRAF)" }, "matchType": { "type": "string", "description": "Match Type", "enum": [ "EXACT", "STARTS_WITH", "PARTIAL", "NO_MATCH" ] }, "queryType": { "type": "string", "description": "Query Type", "enum": [ "GENE", "ALTERATION", "VARIANT", "REGION" ] }, "region": { "type": "string", "description": "Matching Region (e.g: 13:32968940-32968940)" }, "variant": { "type": "string", "description": "Matching HGVSG Variant (e.g: 17:g.37880220T>C)" } } }, "Snpeff": { "type": "object", "properties": { "license": { "type": "string", "description": "license" } } }, "StatsByTumorType": { "type": "object", "properties": { "ageAtDx": { "type": "integer", "format": "int32", "description": "Median Age at Dx" }, "fBiallelic": { "type": "number", "format": "double", "description": "Frequency Of Biallelic" }, "fCancerTypeCount": { "type": "number", "format": "double", "description": "Frequency Of Cancer Type Count" }, "hrdScore": { "description": "Hrd Score", "$ref": "#/definitions/HrdScore" }, "msiScore": { "type": "number", "format": "double", "description": "Msi Score" }, "nCancerTypeCount": { "type": "integer", "format": "int32", "description": "Number Of Cancer Type Count" }, "numberOfGermlineHomozygous": { "type": "integer", "format": "int32", "description": "Number Of Germline Homozygous Per Tumor Type" }, "numberWithSig": { "type": "integer", "format": "int32", "description": "Number of Variants with Signature" }, "tmb": { "type": "number", "format": "double", "description": "Median TMB" }, "tumorType": { "type": "string", "description": "Tumor Type" } } }, "TranscriptConsequenceSummary": { "type": "object", "required": [ "transcriptId" ], "properties": { "aminoAcidAlt": { "type": "string", "description": "Alt Amino Acid" }, "aminoAcidRef": { "type": "string", "description": "Reference Amino Acid" }, "aminoAcids": { "type": "string", "description": "Amino acids change" }, "codonChange": { "type": "string", "description": "Codon change" }, "consequenceTerms": { "type": "string", "description": "Consequence terms (comma separated)" }, "entrezGeneId": { "type": "string", "description": "Entrez gene id" }, "exon": { "type": "string" }, "hgvsc": { "type": "string", "description": "HGVSc" }, "hgvsp": { "type": "string", "description": "HGVSp" }, "hgvspShort": { "type": "string", "description": "HGVSp short" }, "hugoGeneSymbol": { "type": "string", "description": "Hugo gene symbol" }, "polyphenPrediction": { "type": "string", "description": "Polyphen Prediction" }, "polyphenScore": { "type": "number", "format": "double", "description": "Polyphen Score" }, "proteinPosition": { "description": "Protein position (start and end)", "$ref": "#/definitions/IntegerRange" }, "refSeq": { "type": "string", "description": "RefSeq id" }, "siftPrediction": { "type": "string", "description": "Sift Prediction" }, "siftScore": { "type": "number", "format": "double", "description": "Sift Score" }, "transcriptId": { "type": "string", "description": "Transcript id" }, "uniprotId": { "type": "string", "description": "Uniprot ID" }, "variantClassification": { "type": "string", "description": "Variant classification" } } }, "VariantAnnotationSummary": { "type": "object", "required": [ "transcriptConsequenceSummaries", "transcriptConsequenceSummary", "transcriptConsequences", "variant" ], "properties": { "assemblyName": { "type": "string", "description": "Assembly name" }, "canonicalTranscriptId": { "type": "string", "description": "Canonical transcript id" }, "genomicLocation": { "description": "Genomic location", "$ref": "#/definitions/GenomicLocation" }, "strandSign": { "type": "string", "description": "Strand (- or +)" }, "transcriptConsequenceSummaries": { "type": "array", "description": "All transcript consequence summaries", "items": { "$ref": "#/definitions/TranscriptConsequenceSummary" } }, "transcriptConsequenceSummary": { "description": "Most impactful transcript consequence of canonical transcript or if non-existent any transcript", "$ref": "#/definitions/TranscriptConsequenceSummary" }, "transcriptConsequences": { "type": "array", "description": "(Deprecated) Transcript consequence summaries (list of one when using annotation/, multiple when using annotation/summary/", "items": { "$ref": "#/definitions/TranscriptConsequenceSummary" } }, "variant": { "type": "string", "description": "Variant key" }, "variantType": { "type": "string", "description": "Variant type" } } }, "Vcf": { "type": "object", "properties": { "alt": { "type": "string", "description": "alt" }, "position": { "type": "string", "description": "position" }, "ref": { "type": "string", "description": "ref" } } } } }